Double Terminator 60
DT60
Data
| Parameter | Value | Unit |
|---|---|---|
| Strength | 99.09 | - |
| Low | 96.66 | - |
| Strain | DH5α |
|---|---|
| Plasmid | pGR |
| ori | ColE1 |
| Resistance | Amp |
Description
Part of a library of double terminators intended for use in genome integration, so that the inserted circuit would not affect nearby genes and insulate the circuit from surrounding genetic context. These terminators were generated by the concatenation of sequences from other sources (libraries also contemplated in this database). Selecting high bidirectional strength and low recombination propensity, the authors chose the six best double terminators, which are displayed in this database, to create genomic landing pads.
Characterization
Parts were characterized on E. coli DH5α in custom M9 minimal media, in 96-well flow citometer assays. These terminators were characterized in a similar manner to a previous library of terminators created by the same group (Chen, 2014), by placing the terminators between two coding sequences
of fluorescent reporters and calculating a ration of upstream/downstream expression with flow citometry. Again, the strength values were adapted to a percentile metric, in order to fit with other characterization data.
The strength percentile displayed here is then 100 * (1 - (1/Str)), where "Str" is the value reported on the publication.
The "Low" value in Data represents the terminator strength in the reverse direction.
Sequences
Terminator
ACATTTAATAAAAAAAGGGCGGTCGCAAGATCGCCCTTTTTTACGTATGACACAGTGAAAAATGGCGCCCATCGGCGCCATTTTTTTATG
Download
Reference
Park, Y., Espah Borujeni, A., Gorochowski, T. E., Shin, J. & Voigt, C. A. Precision design of stable genetic circuits carried in highly‐insulated E. coli genomic landing pads. Mol. Syst. Biol. 16, (2020).
https://doi.org/10.15252/msb.20209584